Browse wiki
Sequence 1137(hCAP-E (RE-2) , hCAPE (RE2) ) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Structural maintenance of chromosomes 2 E … Structural maintenance of chromosomes 2 Ensembl: ENSG00000136824 UniGene: Hs.119023 EntrezGene: 10592 Ensembl Chr9: 105896362 - 105943519 Strand: 1 GO terms: 0000166 0000228 0000796 0005515 0005524 0005634 0005694 0005737 0006259 0007049 0007067 0007076 0016887 0046982 0051276 005130167 0007076 0016887 0046982 0051276 0051301 |
Design | SiRNA + |
Name | hCAP-E (RE-2) , hCAPE (RE2) + |
Sequence | siRNA sense (21b) CATATTGGACTCCATCTGCTT / siRNA antisense (21b) GCAGATGGAGTCCAATATGTT |
Target | SMC2 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:29 + |
hide properties that link here |
No properties link to this page. |