Browse wiki
Sequence 1130(siSMAD2.2) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | SMAD family member 2 Ensembl: ENSG0000017 … SMAD family member 2 Ensembl: ENSG00000175387 UniGene: Hs.12253 EntrezGene: 4087 Ensembl Chr18: 43613464 - 43710924 Strand: -1 GO terms: 0001707 0003690 0005622 0005634 0005667 0005737 0006350 0006355 0007179 0007242 0008134 0009952 0016563 0045165 0045944 0048340 005109852 0016563 0045165 0045944 0048340 0051098 |
Design | SiRNA + |
Name | siSMAD2.2 + |
Sequence | siRNA sense (21b) ACTAGAATGTGCACCATAATT / siRNA antisense (21b) TTATGGTGCACATTCTAGTTA |
Target | SMAD2 (Homo sapiens) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:57 + |
hide properties that link here |
No properties link to this page. |