Browse wiki
Sequence 1124(mSHPS-1 , mSHPS1) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Signal-regulatory protein alpha Ensembl: … Signal-regulatory protein alpha Ensembl: ENSMUSG00000037902 UniGene: Mm.1682 EntrezGene: 19261 Ensembl Chr2: 129418650 - 129457964 Strand: 1 GO terms: 0004872 0005515 0005615 0005887 0006910 0006911 0006928 0007010 0007015 0007160 0016020 0045309 005076610 0007015 0007160 0016020 0045309 0050766 |
Design | SiRNA + |
Name | mSHPS-1 , mSHPS1 + |
Sequence | siRNA sense (21b) GGTGACTCAGCCTGAGAAATT / siRNA antisense (21b) TTTCTCAGGCTGAGTCACCTT |
Target | Sirpa ( Mus musculus ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:00 + |
hide properties that link here |
No properties link to this page. |