Browse wiki
Sequence 1104(Control) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Ribosomal protein S6 kinase, 70kDa, polype … Ribosomal protein S6 kinase, 70kDa, polypeptide 1 Ensembl: ENSG00000108443 UniGene: Hs.463642 EntrezGene: 6198 Ensembl Chr17: 55325225 - 55382564 Strand: 1 GO terms: 0000166 0004672 0004674 0004713 0005524 0005737 0006468 0007165 0007281 0016740 0019717 0030054 0043491 004520281 0016740 0019717 0030054 0043491 0045202 |
Design | SiRNA + |
Name | Control + |
Sequence | siRNA sense (21b) TTCGAAGAGGGCCCGTAGGTT / siRNA antisense (21b) CCTACGGGCCCTCTTCGAATT |
Target | RPS6KB1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:05 + |
hide properties that link here |
No properties link to this page. |