Browse wiki
Sequence 1055(RAB12) |
Application | Gene expression + |
---|---|
Chemistry | DNA + |
Description | RAB12, member RAS oncogene family Ensembl … RAB12, member RAS oncogene family Ensembl: ENSG00000206418 UniGene: Hs.270074 EntrezGene: 201475 Ensembl Chr18: 8599443 - 8629380 Strand: 1 GO terms: 0000166 0003777 0003924 0005515 0005524 0005525 0005622 0005794 0005875 0006886 0006913 0007018 0007165 0007264 0015031 001602013 0007018 0007165 0007264 0015031 0016020 |
Design | Primer set + |
Name | RAB12 + |
Sequence | Forward PCR primer (20b) TGCGGTTCTGTGAAGCAAGT / Reverse PCR primer (20b) CAACAGCATCGGACATGTGG |
Target | RAB12 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:07 + |
hide properties that link here |
No properties link to this page. |