Browse wiki
Sequence 1043(DNA-PKcs-1 , DNAPKcs1) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Protein kinase, DNA-activated, catalytic p … Protein kinase, DNA-activated, catalytic polypeptide Ensembl: ENSG00000121031 UniGene: Hs.700597 EntrezGene: 5591 Ensembl Chr8: 48848222 - 49035296 Strand: -1 GO terms: 0000723 0001756 0002328 0003677 0004677 0005488 0005515 0005524 0005634 0006302 0006303 0006310 0006464 0006915 0007420 0007507 0010332 0016740 0016773 0033077 0033152 003315332 0016740 0016773 0033077 0033152 0033153 |
Design | SiRNA + |
Name | DNA-PKcs-1 , DNAPKcs1 + |
Sequence | siRNA sense (21b) GATCGCACCTTACTCTGTTTT / siRNA antisense (21b) AACAGAGTAAGGTGCGATCTT |
Target | PRKDC ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:47 + |
hide properties that link here |
No properties link to this page. |