Browse wiki
Sequence 1000(DJ-1 , DJ1) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Parkinson disease ( autosomal recessive, early onset ) 7 Ensembl: ENSG00000116288 UniGene: Hs.419640 EntrezGene: 11315 Ensembl Chr1: 7944310 - 7967926 Strand: 1 GO terms: 0005515 0005634 0005737 0006457 0007265 0008344 0042542 0051583 |
Design | SiRNA + |
Name | DJ-1 , DJ1 + |
Sequence | siRNA sense (21b) TGGAGACGGTCATCCCTGTTT / siRNA antisense (21b) ACAGGGATGACCGTCTCCATT |
Target | PARK7 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:47 + |
hide properties that link here |
No properties link to this page. |