Browse wiki
Sequence 554 (ISIS HuASO) |
Application | Gene silencing + |
---|---|
Chemistry | MoC*moT*moC*moA*moG*T*A*A*C*A*T*T*G*A*C*moA*moC*moC*moA*moC + |
Description | Huntingtin ( Huntington disease ) Ensembl … Huntingtin ( Huntington disease ) Ensembl: ENSG00000197386 UniGene: Hs.518450 EntrezGene: 3064 Ensembl Chr4: 3046206 - 3215485 Strand: 1 GO terms: 0003714 0005215 0005246 0005515 0005625 0005634 0005737 0005794 0006915 0006916 0006917 0007610 0008017 0009405 0009887 0009952 0016023 0016234 0047496 004834187 0009952 0016023 0016234 0047496 0048341 |
Design | MOE gapmer + |
Name | IONIS HTTRx , ISIS HuASO , ISIS 443139 + |
Sequence | CTCAGTAACATTGACACCAC |
Target | HTT ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 9 June 2018 08:44:27 + |
hide properties that link here |
No properties link to this page. |