Sequence 1108(NgR-1 , NgR1)
From Wikisequences
Sequence NgR-1 , NgR1 | |
---|---|
Target | Rtn4r ( Rattus norvegicus ) |
Description | Reticulon 4 receptor
Ensembl: ENSRNOG00000030920 UniGene: Rn.45686 EntrezGene: 113912 Ensembl Chr11: 84839082 - 84840482 Strand: -1 GO terms: 0004872 0005515 0005783 0005886 0007409 0048503 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) TCTCACCATCCTGTGGCTGTT / siRNA antisense (21b) CAGCCACAGGATGGTGAGATT |
Application | gene silencing |
Name | NgR-1 , NgR1 |
References
Disinhibition of neurotrophin-induced dorsal root ganglion cell neurite outgrowth on CNS myelin by siRNA-mediated knockdown of NgR, p75NTR and Rho-A.Ahmed Z, Dent RG, Suggate EL, Barrett LB, Seabright RJ, Berry M, Logan A.Mol Cell Neurosci. 2005 Mar;28(3) :509-23.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478