Sequence 1076(RbAp46)
From Wikisequences
Sequence RbAp46 | |
---|---|
Target | RBBP7 ( Homo sapiens ) |
Description | Retinoblastoma binding protein 7
Ensembl: ENSG00000102054 UniGene: Hs.495755 EntrezGene: 5931 Ensembl ChrX: 16772385 - 16798386 Strand: -1 GO terms: 0005515 0005634 0006260 0006350 0006355 0007275 0008283 0016568 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GGAGAAGTAAACCGTGCTCTT / siRNA antisense (21b) GAGCACGGTTTACTTCTCCTT |
Application | gene silencing |
Name | RbAp46 |
References
Mis16 and Mis18 are required for CENP-A loading and histone deacetylation at centromeres.Hayashi T, Fujita Y, Iwasaki O, Adachi Y, Takahashi K, Yanagida M.Cell. 2004 Sep 17;118(6) :715-29.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478